У нас вы можете посмотреть бесплатно How Does COVID-19 Testing Actually Work? или скачать в максимальном доступном качестве, видео которое было загружено на ютуб. Для загрузки выберите вариант из формы ниже:
Если кнопки скачивания не
загрузились
НАЖМИТЕ ЗДЕСЬ или обновите страницу
Если возникают проблемы со скачиванием видео, пожалуйста напишите в поддержку по адресу внизу
страницы.
Спасибо за использование сервиса ClipSaver.ru
Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody. Earlier videos: PCR - • Everything You Could Want To Know About PCR Gel Electrophoresis - • Gel Electrophoresis: How It Works and How ... ___________________________________________________________________ Try tab for a cause today: https://tab.gladly.io/thethoughtempor... ___________________________________________________________________ 00:00 - Introduction 04:00 - Virus Anatomy Overview 09:45 - PCR Overview 13:30 - Performing PCR 20:37 - Testing at Scale and Robots (Opentrons) 23:30 - LAMP overview 27:50 - Performing LAMP (Biofoundry) 30:30 - Pros/Cons of Genetic Tests 31:30 - Antibody Overview 32:50 - Performing Antibody Test 34:00 - How Antibody Tests Work 38:00 - Summary ____________________________________________________________________ Support the show and future projects: Patreon: / thethoughtemporium Nebula: https://go.nebula.tv/thethoughtemporium Ko-Fi: https://ko-fi.com/thoughtemporium Become a member: / @thethoughtemporium Store: https://thethoughtemporium.ca/ ______________________________________________________ Our Social Media Pages: Tiktok: / thethoughtemporium Instagram: / thethoughtemporium Facebook: / thethoughtemporium Twitter: / emporiumthought Website: http://thethoughtemporium.com/ _____________________________________________________ More resources, and citations: Kurzgesagt Covid Overview: • The Coronavirus Explained & What You Shoul... A great writeup about the virus's anatomy: https://bit.ly/2FJq6G8 JOGL: https://app.jogl.io/program/opencovid19 Biofoundry: https://foundry.bio/ Student Outbreak: https://bit.ly/2Qa3vEq Student Outbreak 2: https://bit.ly/34hQgdl Strokes In heathy people: https://bit.ly/2QdQREK Organ Damage: https://bit.ly/3aHONhy Aptamer Tests: https://rsc.li/3j2Fb3I Variations in Test Accuracy: https://bit.ly/2YlojNV Faulty probes: https://bit.ly/3aIPlDJ Contaminated Swabs: https://bit.ly/34fnVEt False positives FDA: https://bit.ly/3gojBFv E protein structure: https://bit.ly/3aN5Yyb MERS fact sheet: https://bit.ly/2CLUaQn Incidence of thromboembolism: https://bit.ly/2YgiBgc Stroke study: https://bit.ly/2E59Pei Stroke 2: https://bit.ly/2Yk8yql Cardiac infection: https://bit.ly/3l5DaWo Asymptomatic infection rate: https://bit.ly/2YgiOju Asymptomatic infection study: https://go.nature.com/2CLO2rb Organ damage in asymptomatic pateints: https://bit.ly/2YfaMHJ Wisconsin LAMP trial: https://bit.ly/3aIQfA7 Healthy people stroke: https://bit.ly/2YmKEuB LAMP Assay design: https://bit.ly/3aJnqUv Mutation geneology: https://bit.ly/34hxqTs Cardiac outcomes: https://bit.ly/3hjJBmo False negative rate: https://bit.ly/3j47I95 ACE2 distribution: https://go.nature.com/3aJsMyR Long Haulers article: https://bit.ly/2EgU9nP Long haulers Video: • COVID-19 Antibodies: Why is Everyone Testi... Complete protein models: https://bit.ly/32akpIS Antibody test: https://bit.ly/2CIXT0S _________________________________________________________________________________ Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: http://binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA MembraneR - CGGTGATCCAATTTATTCTGTAAAC NucleoF - AAATGAAAGATCTCAGTCCAAGATG NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT Original Primers: N1F - GACCCCAAAATCAGCGAAAT N2F - ttacaaacattggccgcaaa N3F - GGGAGCCTTGAATACACCAAAA N2R - GCGCGACATTCCGAAGAA N2-LF - gggggcaaattgtgcaatttg N2-B3 - gacttgatctttgaaatttggatct N2-F3 - accaggaactaatcagacaag