FASTA format скачать в хорошем качестве

FASTA format

FASTA format is a simple and widely used text-based format for representing nucleotide or protein sequences. Each FASTA file begins with a single-line description that starts with a greater-than symbol, followed by lines of sequence data. For example, a DNA sequence in FASTA format might look like: "greater-than" Sample_Sequence ATGCGTACGTAGCTAGCTAGCTAGCTA This format is compatible with most bioinformatics tools, including BLAST, and is essential for storing, sharing, and analyzing genetic or protein sequences in a standardized way.